Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0000745 | |||
Gene | SPECC1 | Organism | Human |
Genome Locus | chr17:20107645-20109225:+ | Build | hg19 |
Disease | Gastric Cancer | ICD-10 | Stomach, Malignant neoplasm of unspecified (C16.9) |
DBLink | Link to database | PMID | 28974900 |
Experimental Method | |||
Sample Type | Colorectal Tissues | Comparison | 60 GC tissues and paired adjacent non-tumor tissues, as well as 60 plasma samples from GC patients and 60 plasma samples from healthy controls |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward GTTGAAAGTAGCCCGAGCAG ReverseACGTGGCACAGACCTCTCTC | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
Citation | |||
Huang, M, He, YR, Liang, LC, Huang, Q, Zhu, ZQ (2017). Circular RNA hsa_circ_0000745 may serve as a diagnostic marker for gastric cancer. World J. Gastroenterol., 23, 34:6330-6338. |